Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_103809 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Colorectal Cancer | ICD-10 | Malignant neoplasm of rectosigmoid junction (C19) |
DBLink | Link to database | PMID | 30249393 |
Experimental Method | |||
Sample Type | Tissues and Cell lines | Comparison | 30 CRC tissues and matched non-tumor normal tissue specimens and Human CRC cell lines |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward ACGCATTCTTCGAGACCTCT ReverseTGCCTGTAACTCCTCTTCAGT | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Bian, L, Zhi, X, Ma, L, Zhang, J, Chen, P, Sun, S, Li, J, Sun, Y, Qin, J (2018). Hsa_circRNA_103809 regulated the cell proliferation and migration in colorectal cancer via miR-532-3p / FOXO4 axis. Biochem. Biophys. Res. Commun., 505, 2:346-352. |